Transcript: Human NM_213599.2

Homo sapiens anoctamin 5 (ANO5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
ANO5 (203859)
Length:
6661
CDS:
318..3059

Additional Resources:

NCBI RefSeq record:
NM_213599.2
NBCI Gene record:
ANO5 (203859)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_213599.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153059 GCCTGCAAAGCGATTCAATTT pLKO.1 455 CDS 100% 13.200 18.480 N ANO5 n/a
2 TRCN0000453552 TTGGATTTGTTACACTATTTG pLKO_005 2356 CDS 100% 13.200 9.240 N ANO5 n/a
3 TRCN0000158359 CCTCGAACATACCAGGAGTAT pLKO.1 1953 CDS 100% 4.950 3.465 N ANO5 n/a
4 TRCN0000153736 CCTGGAAACTTACCACTCAAT pLKO.1 2443 CDS 100% 4.950 3.465 N ANO5 n/a
5 TRCN0000150955 GCTATGTGTAAACACAGGAAA pLKO.1 1611 CDS 100% 4.950 3.465 N ANO5 n/a
6 TRCN0000151017 GATTCTATCTTCTTCCGAGAT pLKO.1 522 CDS 100% 4.050 2.835 N ANO5 n/a
7 TRCN0000156925 GCAGTGACTAAGGAGATGGAA pLKO.1 1638 CDS 100% 3.000 2.100 N ANO5 n/a
8 TRCN0000157856 CCTATGCTGAAGTCTTGGGAA pLKO.1 742 CDS 100% 2.640 1.848 N ANO5 n/a
9 TRCN0000153108 GCCTATGACAGGATATGTGAA pLKO.1 2630 CDS 100% 4.950 2.970 N ANO5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_213599.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.