Transcript: Human NR_002594.1

Homo sapiens solute carrier family 7 member 5 pseudogene 2 (SLC7A5P2), non-coding RNA.

Source:
NCBI, updated 2018-06-03
Taxon:
Homo sapiens (human)
Gene:
SLC7A5P2 (387254)
Length:
2552
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_002594.1
NBCI Gene record:
SLC7A5P2 (387254)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_002594.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060269 GCTCGTAGCCTGCCACTCCGT pLKO.1 595 3UTR 100% 0.000 0.000 N SLC7A5P2 n/a
2 TRCN0000059818 CCGGCCTTCATCGCAGTACAT pLKO.1 499 3UTR 100% 1.650 0.825 Y SLC7A5P1 n/a
3 TRCN0000059821 CGCCTACATGCTGGACGTCTA pLKO.1 430 3UTR 100% 1.350 0.675 Y SLC7A5P1 n/a
4 TRCN0000060272 GCTCTGGATCGAGCTGCTCAT pLKO.1 475 3UTR 100% 1.350 0.675 Y SLC7A5P2 n/a
5 TRCN0000059820 CGCCTTCCTCAAGCTCTGGAT pLKO.1 463 3UTR 100% 0.880 0.440 Y SLC7A5P1 n/a
6 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 2354 3UTR 100% 13.200 6.600 Y IQCC n/a
7 TRCN0000426198 GGATCGAGCTGCTCATCATTC pLKO_005 480 3UTR 100% 10.800 5.400 Y Slc7a5 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1615 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1615 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_002594.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.