Transcript: Mouse NR_003564.1

Mus musculus predicted gene 15698 (Gm15698), non-coding RNA.

Source:
NCBI, updated 2017-04-30
Taxon:
Mus musculus (mouse)
Gene:
Gm15698 (217066)
Length:
812
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003564.1
NBCI Gene record:
Gm15698 (217066)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_003564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111912 CCATAACCTCCCTAATCAATT pLKO.1 676 3UTR 100% 13.200 9.240 N Gm15698 n/a
2 TRCN0000111914 CCCTATTCTCCTCCTCTAGAT pLKO.1 515 3UTR 100% 4.950 3.465 N Gm15698 n/a
3 TRCN0000111911 GACCTGCTAAAGGCTTCTCAA pLKO.1 542 3UTR 100% 4.950 3.465 N Gm15698 n/a
4 TRCN0000111910 GCTAATGAACCACTTTCCAAT pLKO.1 599 3UTR 100% 4.950 3.465 N Gm15698 n/a
5 TRCN0000111913 GAGCACAGTGTTGGCGCTCAA pLKO.1 304 3UTR 100% 1.350 0.945 N Gm15698 n/a
6 TRCN0000111927 CCAGCTCCTTGATGAGATGAA pLKO.1 385 3UTR 100% 4.950 2.475 Y 2210409E12Rik n/a
7 TRCN0000111928 TGAGGGAATGTGGCTTCACTT pLKO.1 411 3UTR 100% 4.950 2.475 Y 2210409E12Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.