Transcript: Mouse NR_003619.2

Mus musculus RIKEN cDNA 6330549D23 gene (6330549D23Rik), non-coding RNA.

Source:
NCBI, updated 2017-05-11
Taxon:
Mus musculus (mouse)
Gene:
6330549D23Rik (229613)
Length:
2828
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003619.2
NBCI Gene record:
6330549D23Rik (229613)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_003619.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182939 CCTAACCAAGATCCAATCTAT pLKO.1 2301 3UTR 100% 5.625 3.938 N 6330549D23Rik n/a
2 TRCN0000179287 GCTGGCATCACTAATGACAAT pLKO.1 1562 3UTR 100% 4.950 2.970 N 6330549D23Rik n/a
3 TRCN0000191353 CCCTTTCCCATCTAAGTTATA pLKO.1 1153 3UTR 100% 13.200 6.600 Y Ints14 n/a
4 TRCN0000200497 CCCATCTAAGTTATATGTCAT pLKO.1 1159 3UTR 100% 4.950 2.475 Y Ints14 n/a
5 TRCN0000182917 CAAGAAGAAATCAAACCTCAT pLKO.1 1729 3UTR 100% 4.050 2.025 Y 6330549D23Rik n/a
6 TRCN0000179176 GACTTGGAAATAGTGGGCTTT pLKO.1 1451 3UTR 100% 4.050 2.025 Y 6330549D23Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003619.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.