Transcript: Mouse NR_003962.1

Mus musculus vomeronasal 2, receptor, pseudogene 11 (Vmn2r-ps11), non-coding RNA.

Source:
NCBI, updated 2013-07-16
Taxon:
Mus musculus (mouse)
Gene:
Vmn2r-ps11 (319210)
Length:
2261
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003962.1
NBCI Gene record:
Vmn2r-ps11 (319210)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_003962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104879 AGATGTAGACAGTGGGTATTA pLKO.1 1584 3UTR 100% 13.200 6.600 Y Vmn2r-ps11 n/a
2 TRCN0000104876 GCGCAATTCTTAGTGACAAAT pLKO.1 662 3UTR 100% 13.200 6.600 Y Vmn2r-ps11 n/a
3 TRCN0000104877 GTGACTCTCATCATACACTTT pLKO.1 742 3UTR 100% 4.950 2.475 Y Vmn2r-ps11 n/a
4 TRCN0000104875 GCTATACTTCATCCAGCGCAA pLKO.1 647 3UTR 100% 2.160 1.080 Y Vmn2r-ps11 n/a
5 TRCN0000104878 CCAAGGATGTTCAAGAACATT pLKO.1 2075 3UTR 100% 0.563 0.281 Y Vmn2r-ps11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.