Transcript: Human NR_023314.4

Homo sapiens thiamine triphosphatase (THTPA), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
THTPA (79178)
Length:
1267
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_023314.4
NBCI Gene record:
THTPA (79178)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_023314.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271651 TTAGCCGTGATCAGTAGTTAA pLKO_005 781 3UTR 100% 13.200 18.480 N THTPA n/a
2 TRCN0000201985 CCATTGATTTCCGCTCGTGTT pLKO.1 746 3UTR 100% 4.050 5.670 N Thtpa n/a
3 TRCN0000271602 GTTTCCGGCCTCAAGACTATC pLKO_005 414 3UTR 100% 10.800 8.640 N THTPA n/a
4 TRCN0000051078 GCCAAGCTGATTGTGTATCTA pLKO.1 389 3UTR 100% 5.625 3.938 N THTPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_023314.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.