Transcript: Human NR_024075.1

Homo sapiens adhesion G protein-coupled receptor E4, pseudogene (ADGRE4P), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
ADGRE4P (326342)
Length:
2732
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024075.1
NBCI Gene record:
ADGRE4P (326342)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024075.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056171 GCAACGGTTCTTACACCAAAT pLKO.1 973 3UTR 100% 10.800 15.120 N ADGRE4P n/a
2 TRCN0000056172 CGACACAGTCAAACGTGGATA pLKO.1 428 3UTR 100% 4.950 6.930 N ADGRE4P n/a
3 TRCN0000056170 GCTGGCAAAGTGCAAGTATAA pLKO.1 279 3UTR 100% 13.200 9.240 N ADGRE4P n/a
4 TRCN0000056168 CCCAGAATTATGGAACATTTA pLKO.1 1453 3UTR 100% 13.200 7.920 N ADGRE4P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024075.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.