Transcript: Human NR_024386.2

Homo sapiens pleckstrin homology and RUN domain containing M1 pseudogene 1 (PLEKHM1P1), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
PLEKHM1P1 (440456)
Length:
2922
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024386.2
NBCI Gene record:
PLEKHM1P1 (440456)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275747 AGGACCTGGATGCCCTATATA pLKO_005 1422 3UTR 100% 15.000 7.500 Y PLEKHM1 n/a
2 TRCN0000275801 GCCTTCTCTGGCCTCTATTAC pLKO_005 1881 3UTR 100% 13.200 6.600 Y PLEKHM1 n/a
3 TRCN0000134245 CATCAGGAACAATGAGAAGAT pLKO.1 1478 3UTR 100% 4.950 2.475 Y PLEKHM1 n/a
4 TRCN0000275803 CATCAGGAACAATGAGAAGAT pLKO_005 1478 3UTR 100% 4.950 2.475 Y PLEKHM1 n/a
5 TRCN0000164055 CCGCATCAGGAACAATGAGAA pLKO.1 1475 3UTR 100% 4.950 2.475 Y PLEKHM1 n/a
6 TRCN0000353699 CCGCATCAGGAACAATGAGAA pLKO_005 1475 3UTR 100% 4.950 2.475 Y PLEKHM1 n/a
7 TRCN0000135182 CCTAAACTCTGATAGCTGCTT pLKO.1 516 3UTR 100% 2.640 1.320 Y PLEKHM1 n/a
8 TRCN0000345633 AGCTGTCCTGCAGCCTAAATT pLKO_005 503 3UTR 100% 15.000 7.500 Y Plekhm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.