Transcript: Human NR_027293.2

Homo sapiens BMS1 pseudogene 20 (BMS1P20), non-coding RNA.

Source:
NCBI, updated 2019-07-15
Taxon:
Homo sapiens (human)
Gene:
BMS1P20 (96610)
Length:
2011
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027293.2
NBCI Gene record:
BMS1P20 (96610)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172958 GACCATCCCGCTCTGTTATAT pLKO.1 561 3UTR 100% 15.000 10.500 N BMS1P20 n/a
2 TRCN0000146331 CCCAGTAACATCTTTGTTGAA pLKO.1 938 3UTR 100% 4.950 2.475 Y BMS1 n/a
3 TRCN0000278475 CCCAGTAACATCTTTGTTGAA pLKO_005 938 3UTR 100% 4.950 2.475 Y BMS1 n/a
4 TRCN0000168428 GAAGACCACAATGGAAGACAA pLKO.1 583 3UTR 100% 4.950 2.475 Y BMS1P20 n/a
5 TRCN0000167923 CAATGGAAGACAAAGGCTTCT pLKO.1 591 3UTR 100% 4.050 2.025 Y BMS1P20 n/a
6 TRCN0000172365 CGAAGACCACAATGGAAGACA pLKO.1 582 3UTR 100% 3.000 1.500 Y BMS1P20 n/a
7 TRCN0000168108 CACAATGGAAGACAAAGGCTT pLKO.1 589 3UTR 100% 2.640 1.320 Y BMS1P20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.