Transcript: Human NR_027460.1

Homo sapiens RRN3 homolog, RNA polymerase I transcription factor pseudogene 3 (RRN3P3), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
RRN3P3 (100131998)
Length:
2492
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027460.1
NBCI Gene record:
RRN3P3 (100131998)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027460.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017979 GCTGCACATATACCTTAATAA pLKO.1 879 3UTR 100% 15.000 7.500 Y RRN3P1 n/a
2 TRCN0000017980 GCTGTGTTCTACACCTTTGTT pLKO.1 967 3UTR 100% 5.625 2.813 Y RRN3P1 n/a
3 TRCN0000017982 CGGAAACCTGAAAGAAGGTTT pLKO.1 1011 3UTR 100% 0.495 0.248 Y RRN3P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027460.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.