Transcript: Mouse NR_027505.2

Mus musculus ring finger protein 126 (Rnf126), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-02-26
Taxon:
Mus musculus (mouse)
Gene:
Rnf126 (70294)
Length:
1446
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027505.2
NBCI Gene record:
Rnf126 (70294)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_027505.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040891 CCTTTGGCATCTTCGACGATA pLKO.1 250 3UTR 100% 4.950 6.930 N Rnf126 n/a
2 TRCN0000040888 GCTTTGAAATAAATGGACGTT pLKO.1 1168 3UTR 100% 2.640 3.696 N Rnf126 n/a
3 TRCN0000040889 GCTCCTCAATCAGTTTGAGAA pLKO.1 514 3UTR 100% 0.495 0.693 N Rnf126 n/a
4 TRCN0000040890 CCCAGTGTGTAAAGAAGACTA pLKO.1 625 3UTR 100% 4.950 3.465 N Rnf126 n/a
5 TRCN0000040892 GAGACCAGGAACACAGAGAAT pLKO.1 129 3UTR 100% 4.950 3.465 N Rnf126 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027505.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.