Transcript: Mouse NR_027506.1

Mus musculus spermatogenesis associated glutamate (E)-rich protein 5, pseudogene 1 (Speer5-ps1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Speer5-ps1 (70365)
Length:
970
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027506.1
NBCI Gene record:
Speer5-ps1 (70365)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_027506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215597 GATGAATCTTCTTCCATATAA pLKO.1 542 3UTR 100% 15.000 7.500 Y Speer4d n/a
2 TRCN0000248365 GATGAATCTTCTTCCATATAA pLKO_005 542 3UTR 100% 15.000 7.500 Y Speer4d n/a
3 TRCN0000248366 CTTAGGGTGAATAGGCCTTTA pLKO_005 571 3UTR 100% 10.800 5.400 Y Speer4d n/a
4 TRCN0000183327 GATCATGACATTTCTACACAA pLKO.1 145 3UTR 100% 4.950 2.475 Y Gm9758 n/a
5 TRCN0000255103 AGGCTGATTGGGCCATCATTC pLKO_005 318 3UTR 100% 10.800 5.400 Y Speer4e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.