Transcript: Human NR_027691.2

Homo sapiens pannexin 2 (PANX2), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
PANX2 (56666)
Length:
3018
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027691.2
NBCI Gene record:
PANX2 (56666)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027691.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155490 GCAGGAGATCGACAACTGTTA pLKO.1 525 3UTR 100% 4.950 6.930 N PANX2 n/a
2 TRCN0000150720 CCTGAGGTGAAGAGTTTATTT pLKO.1 2304 3UTR 100% 15.000 10.500 N PANX2 n/a
3 TRCN0000155858 CTTCCGCAAGAGCAACTTCAT pLKO.1 993 3UTR 100% 4.950 3.465 N PANX2 n/a
4 TRCN0000155313 GCAGTTCTGCGACATCAACAT pLKO.1 1068 3UTR 100% 4.950 3.465 N PANX2 n/a
5 TRCN0000155283 GTGCGTCATGAACCTCATCAT pLKO.1 945 3UTR 100% 4.950 3.465 N PANX2 n/a
6 TRCN0000155831 CTTCATCTTCCGCAAGAGCAA pLKO.1 987 3UTR 100% 2.640 1.848 N PANX2 n/a
7 TRCN0000155075 GCGCAAGAAGATGAAGTGGAT pLKO.1 1329 3UTR 100% 2.640 1.848 N PANX2 n/a
8 TRCN0000154754 GCCCTGAGGTGAAGAGTTTAT pLKO.1 2302 3UTR 100% 13.200 7.920 N PANX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027691.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.