Transcript: Mouse NR_027970.1

Mus musculus hepatic nuclear factor 4 alpha, opposite strand (Hnf4aos), long non-coding RNA.

Source:
NCBI, updated 2017-05-12
Taxon:
Mus musculus (mouse)
Gene:
Hnf4aos (68314)
Length:
843
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027970.1
NBCI Gene record:
Hnf4aos (68314)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_027970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177223 GTTCTATACAACAGGCAATAA pLKO.1 691 3UTR 100% 13.200 9.240 N Hnf4aos n/a
2 TRCN0000176653 CTATACAACAGGCAATAAGTA pLKO.1 694 3UTR 100% 5.625 3.938 N Hnf4aos n/a
3 TRCN0000181540 GCACTGAAGGAAGCTAAAGAT pLKO.1 562 3UTR 100% 5.625 3.938 N Hnf4aos n/a
4 TRCN0000200315 GAAGGCACTGAAGGAAGCTAA pLKO.1 558 3UTR 100% 4.950 3.465 N Hnf4aos n/a
5 TRCN0000182351 GCAAACTGATGTGCAGACACA pLKO.1 416 3UTR 100% 2.640 1.848 N Hnf4aos n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.