Transcript: Mouse NR_027974.1

Mus musculus RIKEN cDNA 3110070M22 gene (3110070M22Rik), long non-coding RNA.

Source:
NCBI, updated 2013-11-05
Taxon:
Mus musculus (mouse)
Gene:
3110070M22Rik (67304)
Length:
1154
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027974.1
NBCI Gene record:
3110070M22Rik (67304)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_027974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178248 GCTGGACACATAGTGATATAT pLKO.1 845 3UTR 100% 15.000 21.000 N 3110070M22Rik n/a
2 TRCN0000182234 CCCACACTCAATCAGCATCAT pLKO.1 600 3UTR 100% 4.950 3.465 N 3110070M22Rik n/a
3 TRCN0000178048 GCTAACTTTAGTGAGGTAGTT pLKO.1 880 3UTR 100% 4.950 3.465 N 3110070M22Rik n/a
4 TRCN0000181862 GATTTCTCAAGGCTTTGCTAC pLKO.1 358 3UTR 100% 4.050 2.835 N 3110070M22Rik n/a
5 TRCN0000182545 GCTACAGAATCGCTTCAGATG pLKO.1 512 3UTR 100% 4.050 2.835 N 3110070M22Rik n/a
6 TRCN0000181938 GCACTGACCAAGTGGAAATAT pLKO.1 824 3UTR 100% 15.000 9.000 N 3110070M22Rik n/a
7 TRCN0000182233 CGGTTAAGAACACTGACTGCT pLKO.1 453 3UTR 100% 2.640 1.320 Y 3110070M22Rik n/a
8 TRCN0000182750 CTCAGCGGTTAAGAACACTGA pLKO.1 448 3UTR 100% 2.640 1.320 Y 3110070M22Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.