Transcript: Mouse NR_028114.1

Mus musculus peroxisomal biogenesis factor 16 (Pex16), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Pex16 (18633)
Length:
1179
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028114.1
NBCI Gene record:
Pex16 (18633)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_028114.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285629 AGCGGGAAATTCGGCAGAAAC pLKO_005 615 3UTR 100% 10.800 7.560 N Pex16 n/a
2 TRCN0000285626 CCTTGGATGGTGACCACAATC pLKO_005 489 3UTR 100% 10.800 7.560 N Pex16 n/a
3 TRCN0000181399 CTACTGTCTGGTGTGGTAGAT pLKO.1 773 3UTR 100% 4.950 3.465 N Pex16 n/a
4 TRCN0000285630 CTACTGTCTGGTGTGGTAGAT pLKO_005 773 3UTR 100% 4.950 3.465 N Pex16 n/a
5 TRCN0000198545 GATTCACACGAGCTGTCTGAA pLKO.1 158 3UTR 100% 4.950 3.465 N Pex16 n/a
6 TRCN0000276741 GATTCACACGAGCTGTCTGAA pLKO_005 158 3UTR 100% 4.950 3.465 N Pex16 n/a
7 TRCN0000181987 CTGCTGCTATACTACCTGCTA pLKO.1 872 3UTR 100% 2.640 1.584 N Pex16 n/a
8 TRCN0000276787 CTGCTGCTATACTACCTGCTA pLKO_005 872 3UTR 100% 2.640 1.584 N Pex16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028114.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.