Transcript: Mouse NR_028142.1

Mus musculus patatin-like phospholipase domain containing 2 (Pnpla2), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Pnpla2 (66853)
Length:
2717
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028142.1
NBCI Gene record:
Pnpla2 (66853)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_028142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184511 GCACATTTATCCCGGTGTACT pLKO.1 615 3UTR 100% 4.950 6.930 N Pnpla2 n/a
2 TRCN0000249777 ACGGAGAGAACGTCATCATAT pLKO_005 549 3UTR 100% 13.200 10.560 N Pnpla2 n/a
3 TRCN0000249778 GTGAAGCAGGTGCCAACATTA pLKO_005 369 3UTR 100% 13.200 9.240 N Pnpla2 n/a
4 TRCN0000249774 CATCTCCCTGACTCGTGTTTC pLKO_005 526 3UTR 100% 10.800 7.560 N Pnpla2 n/a
5 TRCN0000249776 CTATGTGGATGGCGGCATTTC pLKO_005 670 3UTR 100% 10.800 7.560 N Pnpla2 n/a
6 TRCN0000249775 TGCTGTGGAATGAGGACATAG pLKO_005 1757 3UTR 100% 10.800 7.560 N Pnpla2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.