Transcript: Mouse NR_033123.1

Mus musculus RIKEN cDNA 4933409K07 gene (4933409K07Rik), non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
4933409K07Rik (108816)
Length:
4551
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033123.1
NBCI Gene record:
4933409K07Rik (108816)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_033123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032579 GCAGAGCACAAGTAGTCATAA pLKO.1 3674 3UTR 100% 13.200 6.600 Y Kif24 n/a
2 TRCN0000032582 ACCAGAATCTTCTGCGGCAAA pLKO.1 3465 3UTR 100% 4.050 2.025 Y Kif24 n/a
3 TRCN0000032583 CGGACGTGTCACTCCCTGATT pLKO.1 3615 3UTR 100% 1.650 0.825 Y Kif24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.