Transcript: Human NR_033142.2

Homo sapiens NDC1 transmembrane nucleoporin (NDC1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NDC1 (55706)
Length:
4431
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033142.2
NBCI Gene record:
NDC1 (55706)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072710 GCAATACAAGTTCTTGCGTTT pLKO.1 508 3UTR 100% 4.050 5.670 N NDC1 n/a
2 TRCN0000286641 GCAATACAAGTTCTTGCGTTT pLKO_005 508 3UTR 100% 4.050 5.670 N NDC1 n/a
3 TRCN0000072712 CGACACTACCAGCTATCCTTA pLKO.1 1671 3UTR 100% 4.950 3.960 N NDC1 n/a
4 TRCN0000216034 CAGATGCCCAAATGCATATTT pLKO.1 1581 3UTR 100% 15.000 10.500 N Ndc1 n/a
5 TRCN0000293997 CGCAAAGTCCTCAGCTAATAA pLKO_005 1329 3UTR 100% 15.000 10.500 N NDC1 n/a
6 TRCN0000072711 CCTGTATAGTTCCTATGTAAT pLKO.1 106 3UTR 100% 13.200 9.240 N NDC1 n/a
7 TRCN0000286581 CCTGTATAGTTCCTATGTAAT pLKO_005 106 3UTR 100% 13.200 9.240 N NDC1 n/a
8 TRCN0000072709 CGCACTTAGTAGCAGCATCAT pLKO.1 1620 3UTR 100% 4.950 3.465 N NDC1 n/a
9 TRCN0000286582 CGCACTTAGTAGCAGCATCAT pLKO_005 1620 3UTR 100% 4.950 3.465 N NDC1 n/a
10 TRCN0000072708 GTGTTCATTACACTGCTGATA pLKO.1 1956 3UTR 100% 4.950 3.465 N NDC1 n/a
11 TRCN0000286583 GTGTTCATTACACTGCTGATA pLKO_005 1956 3UTR 100% 4.950 3.465 N NDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.