Transcript: Human NR_033732.1

Homo sapiens BCL6 corepressor pseudogene 1 (BCORP1), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
BCORP1 (286554)
Length:
3668
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033732.1
NBCI Gene record:
BCORP1 (286554)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033514 GCAAGATACCTCTTGGCACTT pLKO.1 1056 3UTR 100% 0.405 0.567 N BCORP1 n/a
2 TRCN0000420956 CTCAAGGATGTAAAGCCTTTC pLKO_005 1144 3UTR 100% 6.000 4.200 N BCORP1 n/a
3 TRCN0000416905 CCAGGTAGCTATGGATGTGAT pLKO_005 364 3UTR 100% 4.950 3.465 N BCORP1 n/a
4 TRCN0000033516 CTGCCTGATAAGCAGCAGAAA pLKO.1 836 3UTR 100% 4.950 3.465 N BCORP1 n/a
5 TRCN0000419973 GAAGTTGCCAGAGGACTCTTT pLKO_005 460 3UTR 100% 4.950 3.465 N BCORP1 n/a
6 TRCN0000033518 TGCTACGTTGAGAATGCTGAT pLKO.1 1034 3UTR 100% 4.050 2.835 N BCORP1 n/a
7 TRCN0000033517 CCTCCACCGAAGAATAAGGTT pLKO.1 755 3UTR 100% 3.000 2.100 N BCORP1 n/a
8 TRCN0000033515 CCAATAACAGTGAGAAGCCAT pLKO.1 939 3UTR 100% 2.640 1.848 N BCORP1 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3456 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3456 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.