Transcript: Human NR_034145.1

Homo sapiens long intergenic non-protein coding RNA 670 (LINC00670), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
LINC00670 (284034)
Length:
2767
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_034145.1
NBCI Gene record:
LINC00670 (284034)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_034145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135006 CCCATTAGTTACGTCTTTCTT pLKO.1 1595 3UTR 100% 5.625 7.875 N LINC00670 n/a
2 TRCN0000135518 GAGAGGTGAAATTCGGACATT pLKO.1 479 3UTR 100% 4.950 3.960 N LINC00670 n/a
3 TRCN0000136622 GCTCGTCATACAGAAGAGTGT pLKO.1 400 3UTR 100% 2.640 2.112 N LINC00670 n/a
4 TRCN0000136537 CAAGGAGCTGAGAGGTGAAAT pLKO.1 470 3UTR 100% 13.200 9.240 N LINC00670 n/a
5 TRCN0000135871 CTGCAAATGCTGCACATCTTT pLKO.1 265 3UTR 100% 5.625 3.938 N LINC00670 n/a
6 TRCN0000135723 GAAGGGTTGTCATTTGCCATA pLKO.1 345 3UTR 100% 4.050 2.835 N LINC00670 n/a
7 TRCN0000137462 GAGAAGCATCTGCAACCACAA pLKO.1 158 3UTR 100% 4.050 2.835 N LINC00670 n/a
8 TRCN0000136132 GAAACTGAGAAGCATCTGCAA pLKO.1 152 3UTR 100% 2.640 1.848 N LINC00670 n/a
9 TRCN0000133738 CCACTTCTTTATGTGGTTGTT pLKO.1 2293 3UTR 100% 4.950 2.970 N LINC00670 n/a
10 TRCN0000009295 GCAGGTTTGTTACATAGGTAA pLKO.1 1514 3UTR 100% 4.950 2.475 Y OR11A1 n/a
11 TRCN0000149064 GCAGGTTTGTTACATAGGTAT pLKO.1 1514 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_034145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.