Transcript: Human NR_037187.2

Homo sapiens CENPS-CORT readthrough (CENPS-CORT), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
CENPS-CORT (100526739)
Length:
1496
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037187.2
NBCI Gene record:
CENPS-CORT (100526739)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037187.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262597 AGCTAAAGGCTACACAATTAA pLKO_005 1229 3UTR 100% 15.000 7.500 Y CENPS n/a
2 TRCN0000262596 CTTAGCCAGGAGGAGTAATTC pLKO_005 695 3UTR 100% 13.200 6.600 Y CENPS n/a
3 TRCN0000038878 AGACCTTCTCCTCCTGCAAAT pLKO.1 916 3UTR 100% 10.800 5.400 Y CORT n/a
4 TRCN0000038874 GCCTCCTGACTTTCCTCGCTT pLKO.1 754 3UTR 100% 0.880 0.440 Y CORT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037187.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.