Transcript: Human NR_037566.1

Homo sapiens BCR pseudogene 2 (BCRP2), non-coding RNA.

Source:
NCBI, updated 2019-01-28
Taxon:
Homo sapiens (human)
Gene:
BCRP2 (400892)
Length:
2334
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037566.1
NBCI Gene record:
BCRP2 (400892)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037566.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146724 CCAGATCCAGATACCTAATAA pLKO.1 848 3UTR 100% 15.000 7.500 Y BCRP2 n/a
2 TRCN0000194953 CAGATCCAGATACCTAATAAG pLKO.1 849 3UTR 100% 13.200 6.600 Y BCR n/a
3 TRCN0000147220 CCTAATAAGATGCTGGAATGT pLKO.1 861 3UTR 100% 4.950 2.475 Y BCRP2 n/a
4 TRCN0000147268 GTGTGGATTTAGTTGTGCTTT pLKO.1 1566 3UTR 100% 4.950 2.475 Y BCRP2 n/a
5 TRCN0000082602 GCAGCATTTGGTCTTCCTCTA pLKO.1 906 3UTR 100% 4.050 2.025 Y LOC440820 n/a
6 TRCN0000146832 CCAGATACCTAATAAGATGCT pLKO.1 854 3UTR 100% 2.640 1.320 Y BCRP2 n/a
7 TRCN0000147269 GATACCTAATAAGATGCTGGA pLKO.1 857 3UTR 100% 2.160 1.080 Y BCRP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037566.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.