Transcript: Mouse NR_037581.1

Mus musculus MAGI family member, X-linked (Magix), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Magix (54634)
Length:
2768
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037581.1
NBCI Gene record:
Magix (54634)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_037581.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105826 GCCTCATGCTACTCTTGTGAA pLKO.1 303 3UTR 100% 4.950 6.930 N Magix n/a
2 TRCN0000105827 CACTTCCAGTAACCCAGAATA pLKO.1 374 3UTR 100% 13.200 9.240 N Magix n/a
3 TRCN0000420223 AGTCCAGAGGCAGTGGCTATT pLKO_005 838 3UTR 100% 10.800 7.560 N Magix n/a
4 TRCN0000421302 CACTAGGTGAGGTCCCATAAG pLKO_005 1056 3UTR 100% 10.800 7.560 N Magix n/a
5 TRCN0000415898 TGGAGTCTCGCAGCACCATTT pLKO_005 773 3UTR 100% 10.800 7.560 N Magix n/a
6 TRCN0000105828 AGGGTGTTAGTGGTCTGGATT pLKO.1 251 3UTR 100% 4.950 3.465 N Magix n/a
7 TRCN0000105825 CCTTAGAGCTTTAACCTGGTT pLKO.1 1114 3UTR 100% 2.640 1.848 N Magix n/a
8 TRCN0000105829 TCACTTTAAGTGGAGGCCGAA pLKO.1 476 3UTR 100% 2.160 1.512 N Magix n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037581.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.