Transcript: Mouse NR_037604.1

Mus musculus retinol dehydrogenase 18, pseudogene (Rdh18-ps), non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Rdh18-ps (380674)
Length:
3648
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037604.1
NBCI Gene record:
Rdh18-ps (380674)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_037604.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191266 CTTTGCAAGTATACTGGATGT pLKO.1 455 3UTR 100% 4.050 2.430 N Rdh18-ps n/a
2 TRCN0000191364 CAAACAGAACTTTGCAAGTAT pLKO.1 446 3UTR 100% 5.625 2.813 Y Rdh18-ps n/a
3 TRCN0000190157 GCTGAGGAACAAGACATCTGA pLKO.1 272 3UTR 100% 3.000 1.500 Y Rdh18-ps n/a
4 TRCN0000202357 GAACAAGACATCTGACAGGCT pLKO.1 278 3UTR 100% 0.660 0.330 Y Rdh18-ps n/a
5 TRCN0000041439 CCAAGACAAGTATGTCTTCAT pLKO.1 149 3UTR 100% 0.495 0.248 Y Rdh19 n/a
6 TRCN0000041441 CCTTTCTTGTGGATGCTGTTT pLKO.1 963 3UTR 100% 4.950 2.475 Y Rdh19 n/a
7 TRCN0000041947 GTGAGCCATCTCCAAGACAAA pLKO.1 138 3UTR 100% 4.950 2.475 Y Rdh16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037604.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.