Transcript: Human NR_037687.2

Homo sapiens plexin C1 (PLXNC1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
PLXNC1 (10154)
Length:
3792
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037687.2
NBCI Gene record:
PLXNC1 (10154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037687.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422056 GAAACAACTCTTGCATGTAAA pLKO_005 1342 3UTR 100% 13.200 10.560 N Plxnc1 n/a
2 TRCN0000060647 CGAGGGAAGCACAAGTTCAAA pLKO.1 710 3UTR 100% 5.625 4.500 N PLXNC1 n/a
3 TRCN0000423391 GGCCACTATGAGATATCAAAT pLKO_005 563 3UTR 100% 13.200 9.240 N Plxnc1 n/a
4 TRCN0000359395 TGCAGATGTCTGTCGGAATAT pLKO_005 334 3UTR 100% 13.200 9.240 N PLXNC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037687.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.