Transcript: Mouse NR_037972.1

Mus musculus expressed sequence BB014433 (BB014433), long non-coding RNA.

Source:
NCBI, updated 2017-05-10
Taxon:
Mus musculus (mouse)
Gene:
BB014433 (434285)
Length:
1764
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037972.1
NBCI Gene record:
BB014433 (434285)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_037972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254798 GATAGATGTTCAGGGTAGTGC pLKO_005 1564 3UTR 100% 2.640 3.696 N BB014433 n/a
2 TRCN0000197433 CCCTAAACAAGTTATCTGTGT pLKO.1 486 3UTR 100% 2.640 1.848 N BB014433 n/a
3 TRCN0000198903 GTCCTAACCTTTGTGTCTGGT pLKO.1 689 3UTR 100% 2.640 1.584 N BB014433 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.