Transcript: Mouse NR_038046.1

Mus musculus tyrosyl-tRNA synthetase 2 (mitochondrial) (Yars2), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Yars2 (70120)
Length:
1552
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_038046.1
NBCI Gene record:
Yars2 (70120)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_038046.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250673 GAAGGTGGAGTCAGTATAAAT pLKO_005 1260 3UTR 100% 15.000 21.000 N Yars2 n/a
2 TRCN0000250672 TCGAGGGTATCGGATGATAAC pLKO_005 1238 3UTR 100% 10.800 8.640 N Yars2 n/a
3 TRCN0000201516 CGAGTTGCTCAGAAACGACTT pLKO.1 996 3UTR 100% 4.050 3.240 N Yars2 n/a
4 TRCN0000250670 GAATCACTGTACCTCTAATTA pLKO_005 807 3UTR 100% 15.000 10.500 N Yars2 n/a
5 TRCN0000250671 ACATCACCGTTTGAACTTTAT pLKO_005 893 3UTR 100% 13.200 9.240 N Yars2 n/a
6 TRCN0000215482 GAATGGACTTTCCTTACTTAA pLKO.1 1337 3UTR 100% 13.200 9.240 N Yars2 n/a
7 TRCN0000250674 TCTAGTAATTGGACAACATAT pLKO_005 1310 3UTR 100% 13.200 9.240 N Yars2 n/a
8 TRCN0000191500 GTTCTAGTAATTGGACAACAT pLKO.1 1308 3UTR 100% 4.950 3.465 N Yars2 n/a
9 TRCN0000201793 GTGTCATAGACACATGCCGTA pLKO.1 1192 3UTR 100% 2.160 1.512 N Yars2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_038046.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.