Transcript: Mouse NR_045109.2

Mus musculus POZ (BTB) and AT hook containing zinc finger 1 (Patz1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Patz1 (56218)
Length:
1907
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045109.2
NBCI Gene record:
Patz1 (56218)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_045109.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085929 CCAGATCACTTGAATGGACAT pLKO.1 219 3UTR 100% 4.050 5.670 N Patz1 n/a
2 TRCN0000348107 CTGATACTCTCTGTAGAAATA pLKO_005 1053 3UTR 100% 13.200 9.240 N Patz1 n/a
3 TRCN0000374189 GTAACCGAGAAGGCCAGAAAT pLKO_005 445 3UTR 100% 13.200 9.240 N Patz1 n/a
4 TRCN0000374188 TCAGCGTTTGCATCATCTTTA pLKO_005 804 3UTR 100% 13.200 9.240 N Patz1 n/a
5 TRCN0000085930 CCGTTCTAAGTCCTACTTGAA pLKO.1 650 3UTR 100% 4.950 3.465 N Patz1 n/a
6 TRCN0000085928 GCCAGAATTTCTGGTGCTCAA pLKO.1 1160 3UTR 100% 4.050 3.240 N Patz1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045109.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.