Transcript: Human NR_045587.1

Homo sapiens steroid receptor RNA activator 1 (SRA1), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
SRA1 (10011)
Length:
1473
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045587.1
NBCI Gene record:
SRA1 (10011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_045587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179333 CAGTGGATGGTAGGAGTTAAA pLKO.1 700 3UTR 100% 13.200 18.480 N SRA1 n/a
2 TRCN0000255573 GAGTTCATGTGTTACTCATAA pLKO_005 977 3UTR 100% 13.200 9.240 N SRA1 n/a
3 TRCN0000255575 GCTGGAGGAAAGTTGTCAATA pLKO_005 568 3UTR 100% 13.200 9.240 N SRA1 n/a
4 TRCN0000265668 GGCTTCCAGCAGGCTTCATAA pLKO_005 814 3UTR 100% 13.200 9.240 N SRA1 n/a
5 TRCN0000255574 TCAGTGGATGGTAGGAGTTAA pLKO_005 699 3UTR 100% 13.200 9.240 N SRA1 n/a
6 TRCN0000255576 CCTCCACCTCCTTCAAGTAAG pLKO_005 352 3UTR 100% 10.800 7.560 N SRA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.