Transcript: Human NR_045663.4

Homo sapiens myopalladin (MYPN), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MYPN (84665)
Length:
5599
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045663.4
NBCI Gene record:
MYPN (84665)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_045663.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419952 ACCATCACCTTTCATCGATTA pLKO_005 4473 3UTR 100% 10.800 15.120 N MYPN n/a
2 TRCN0000073455 GCCGACTTCATTGAAGAGCTA pLKO.1 700 3UTR 100% 2.640 3.696 N MYPN n/a
3 TRCN0000416012 GATGAAACACTCACCTAATTT pLKO_005 549 3UTR 100% 15.000 10.500 N MYPN n/a
4 TRCN0000423768 TGATGAATGAAATAGAGTTTC pLKO_005 2809 3UTR 100% 10.800 7.560 N MYPN n/a
5 TRCN0000073456 CGACCCTAACAAGGAAGAGAT pLKO.1 1341 3UTR 100% 4.950 3.465 N MYPN n/a
6 TRCN0000073453 GCCACATAATAAGGTGTCAAA pLKO.1 4616 3UTR 100% 4.950 3.465 N MYPN n/a
7 TRCN0000073457 CGATGGTGTATTCATGCTCTT pLKO.1 3985 3UTR 100% 4.050 2.835 N MYPN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045663.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.