Transcript: Mouse NR_045776.1

Mus musculus RIKEN cDNA 9530080O11 gene (9530080O11Rik), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
9530080O11Rik (319247)
Length:
1479
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045776.1
NBCI Gene record:
9530080O11Rik (319247)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_045776.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183136 CCTGCTGAATTTGTAGGAATA pLKO.1 853 3UTR 100% 10.800 7.560 N 9530080O11Rik n/a
2 TRCN0000183454 GCAGTGATGCTTCTATACTTT pLKO.1 586 3UTR 100% 5.625 3.938 N 9530080O11Rik n/a
3 TRCN0000179480 GCCTGCTGAATTTGTAGGAAT pLKO.1 852 3UTR 100% 4.950 3.465 N 9530080O11Rik n/a
4 TRCN0000195877 CCCAGAGACTAAACTGAGGAT pLKO.1 1160 3UTR 100% 2.640 1.848 N 9530080O11Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045776.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.