Transcript: Mouse NR_045779.1

Mus musculus ubiquitin-like 4A (Ubl4a), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Ubl4a (27643)
Length:
2228
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045779.1
NBCI Gene record:
Ubl4a (27643)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_045779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248968 GAACAACTACAGAGGGATTAT pLKO_005 328 3UTR 100% 13.200 6.600 Y Ubl4a n/a
2 TRCN0000248967 TAAGCTCAACCTAGTTGTTAA pLKO_005 174 3UTR 100% 13.200 6.600 Y Ubl4a n/a
3 TRCN0000248966 GACTGTCAGATTACAACATTG pLKO_005 143 3UTR 100% 10.800 5.400 Y Ubl4a n/a
4 TRCN0000248964 CTGGATGACATCGAACGTTTG pLKO_005 373 3UTR 100% 6.000 3.000 Y Ubl4a n/a
5 TRCN0000007669 GCAGCTGATCTCCAAAGTCTT pLKO.1 267 3UTR 100% 4.950 2.475 Y UBL4A n/a
6 TRCN0000277750 GCAGCTGATCTCCAAAGTCTT pLKO_005 267 3UTR 100% 4.950 2.475 Y UBL4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.