Transcript: Mouse NR_045820.1

Mus musculus RIKEN cDNA A930024E05 gene (A930024E05Rik), long non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
A930024E05Rik (109202)
Length:
1907
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045820.1
NBCI Gene record:
A930024E05Rik (109202)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_045820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200210 CCATTTGCGAACCTGCCATAT pLKO.1 380 3UTR 100% 10.800 7.560 N A930024E05Rik n/a
2 TRCN0000198696 CCACCTTTCCTCATTACCTAT pLKO.1 255 3UTR 100% 4.950 3.465 N A930024E05Rik n/a
3 TRCN0000198275 GCTCAGAAAGAAATTACCTCA pLKO.1 419 3UTR 100% 2.640 1.848 N A930024E05Rik n/a
4 TRCN0000198853 CCTGAAATAGAAGTTGGGCTT pLKO.1 610 3UTR 100% 2.160 1.512 N A930024E05Rik n/a
5 TRCN0000182154 CCTGCCTGTCACTGTCTTTAA pLKO.1 1212 3UTR 100% 13.200 7.920 N A930024E05Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.