Transcript: Mouse NR_045832.1

Mus musculus RIKEN cDNA E130006D01 gene (E130006D01Rik), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2017-05-11
Taxon:
Mus musculus (mouse)
Gene:
E130006D01Rik (269683)
Length:
931
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045832.1
NBCI Gene record:
E130006D01Rik (269683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_045832.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190783 GTCTGTAAGAGGGATAACCCA pLKO.1 527 3UTR 100% 0.750 0.600 N E130006D01Rik n/a
2 TRCN0000190664 GCCTTTCACCTTGCTCTGAAA pLKO.1 667 3UTR 100% 0.495 0.347 N E130006D01Rik n/a
3 TRCN0000215942 CTAATAAGGCAAGCATGTCAT pLKO.1 553 3UTR 100% 4.950 2.970 N E130006D01Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045832.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.