Transcript: Human NR_046082.2

Homo sapiens ubiquitin conjugating enzyme E2 L3 (UBE2L3), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
UBE2L3 (7332)
Length:
3467
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046082.2
NBCI Gene record:
UBE2L3 (7332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_046082.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007208 CCTTAGAATTTATCGTCAGAT pLKO.1 2355 3UTR 100% 4.950 6.930 N UBE2L3 n/a
2 TRCN0000272875 CACTTTCTGGCACCGAGTTTA pLKO_005 1478 3UTR 100% 13.200 9.240 N UBE2L3 n/a
3 TRCN0000007211 CCACCGAAGATCACATTTAAA pLKO.1 830 3UTR 100% 15.000 9.000 N UBE2L3 n/a
4 TRCN0000272963 CCACCGAAGATCACATTTAAA pLKO_005 830 3UTR 100% 15.000 9.000 N UBE2L3 n/a
5 TRCN0000007212 GAATACTCTAAGGACCGTAAA pLKO.1 1019 3UTR 100% 10.800 6.480 N UBE2L3 n/a
6 TRCN0000272913 GAATACTCTAAGGACCGTAAA pLKO_005 1019 3UTR 100% 10.800 6.480 N UBE2L3 n/a
7 TRCN0000272876 AGGTCTGTCTGCCAGTAATTA pLKO_005 888 3UTR 100% 15.000 7.500 Y UBE2L3 n/a
8 TRCN0000007209 CCAGCAGAGTACCCATTCAAA pLKO.1 809 3UTR 100% 5.625 2.813 Y UBE2L3 n/a
9 TRCN0000272938 CCAGCAGAGTACCCATTCAAA pLKO_005 809 3UTR 100% 5.625 2.813 Y UBE2L3 n/a
10 TRCN0000040825 GCTGAAGAGTTTACAAAGAAA pLKO.1 1055 3UTR 100% 5.625 2.813 Y Ube2l3 n/a
11 TRCN0000317881 GCTGAAGAGTTTACAAAGAAA pLKO_005 1055 3UTR 100% 5.625 2.813 Y Ube2l3 n/a
12 TRCN0000007210 GCTAATTTATTGACTTGGCAA pLKO.1 725 3UTR 100% 2.640 1.320 Y UBE2L3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046082.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.