Transcript: Human NR_049732.2

Homo sapiens membrane spanning 4-domains A14 (MS4A14), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MS4A14 (84689)
Length:
3029
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_049732.2
NBCI Gene record:
MS4A14 (84689)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_049732.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060355 CCAGGTAATAAAGGTAGAGAA pLKO.1 902 3UTR 100% 4.950 6.930 N MS4A14 n/a
2 TRCN0000419837 GATAAGCAAGCTCAACTTAAT pLKO_005 1886 3UTR 100% 13.200 10.560 N MS4A14 n/a
3 TRCN0000414067 TCTAAAGATGGACAAGTTAAA pLKO_005 1982 3UTR 100% 13.200 9.240 N MS4A14 n/a
4 TRCN0000060357 CGAAACTGTATTGACTGCATT pLKO.1 177 3UTR 100% 4.950 3.465 N MS4A14 n/a
5 TRCN0000060353 GCCAAGATTCAGAATCCCAAA pLKO.1 2163 3UTR 100% 4.050 2.835 N MS4A14 n/a
6 TRCN0000060354 GCTCTAATCATTGTGGGCTTT pLKO.1 277 3UTR 100% 4.050 2.835 N MS4A14 n/a
7 TRCN0000060356 CCTGAAATACAACACCTACTT pLKO.1 1523 3UTR 100% 4.950 2.970 N MS4A14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_049732.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.