Transcript: Mouse NR_052009.1

Mus musculus fucokinase (Fuk), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Fuk (234730)
Length:
3972
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_052009.1
NBCI Gene record:
Fuk (234730)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_052009.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362129 GCTCCCTGAGCCGTGTATTTA pLKO_005 1382 3UTR 100% 15.000 10.500 N Fuk n/a
2 TRCN0000362205 CTCTGCATGGCTCGGAATATG pLKO_005 898 3UTR 100% 13.200 9.240 N Fuk n/a
3 TRCN0000362203 CTGGATGCCTGCACCTATATG pLKO_005 823 3UTR 100% 13.200 9.240 N Fuk n/a
4 TRCN0000362127 GACCATCTGCTCCTGGTTTAT pLKO_005 2961 3UTR 100% 13.200 9.240 N Fuk n/a
5 TRCN0000025604 GAACAGTTGTTACACTCCTTT pLKO.1 2634 3UTR 100% 4.950 3.465 N Fuk n/a
6 TRCN0000025605 GCTTTGTGAGTGGTCTGGATA pLKO.1 1286 3UTR 100% 4.950 3.465 N Fuk n/a
7 TRCN0000025607 CATTATCCTGACATGCCAGTA pLKO.1 123 3UTR 100% 4.050 2.835 N Fuk n/a
8 TRCN0000025606 GCCTTTATCTGTGCTGGCATT pLKO.1 2583 3UTR 100% 4.050 2.835 N Fuk n/a
9 TRCN0000025608 CTTTCTCTATCTATTGACCAA pLKO.1 3272 3UTR 100% 2.640 1.848 N Fuk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_052009.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.