Transcript: Human NR_052015.4

Homo sapiens RUN and SH3 domain containing 2 (RUSC2), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
RUSC2 (9853)
Length:
4893
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_052015.4
NBCI Gene record:
RUSC2 (9853)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_052015.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137974 GCCCGAAGAAACCCTATCTTT pLKO.1 2599 3UTR 100% 5.625 7.875 N RUSC2 n/a
2 TRCN0000138181 CGCTGGAACGTATGTTGAGTT pLKO.1 1692 3UTR 100% 4.950 6.930 N RUSC2 n/a
3 TRCN0000136974 CTAGACCGAAGATCACAAGAA pLKO.1 2569 3UTR 100% 4.950 6.930 N RUSC2 n/a
4 TRCN0000137751 GAGCACAAGACCTAATCCCTT pLKO.1 268 3UTR 100% 2.640 2.112 N RUSC2 n/a
5 TRCN0000138957 GAGCTTCCACAAAGGAGACAT pLKO.1 4227 3UTR 100% 4.950 3.465 N RUSC2 n/a
6 TRCN0000133952 CCAACTTTCATCTATCCTCTT pLKO.1 570 3UTR 100% 4.050 2.835 N RUSC2 n/a
7 TRCN0000138250 CAGAAAGCCATCTACAGGGTT pLKO.1 4687 3UTR 100% 2.640 1.848 N RUSC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_052015.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.