Transcript: Human NR_072993.2

Homo sapiens enkurin, TRPC channel interacting protein (ENKUR), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ENKUR (219670)
Length:
2838
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_072993.2
NBCI Gene record:
ENKUR (219670)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_072993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421569 CCAACCTCGATACTCTTATTT pLKO_005 768 3UTR 100% 15.000 21.000 N ENKUR n/a
2 TRCN0000122260 CGAAACGAGGAAATAAAGAAA pLKO.1 333 3UTR 100% 5.625 4.500 N ENKUR n/a
3 TRCN0000143973 CCCATGACATTTGCAGTTATT pLKO.1 589 3UTR 100% 13.200 9.240 N ENKUR n/a
4 TRCN0000417883 GGTCCTTTCTACTTATCTATT pLKO_005 838 3UTR 100% 13.200 9.240 N ENKUR n/a
5 TRCN0000121712 CCAAGAAGACTATGATCGTTA pLKO.1 356 3UTR 100% 4.950 3.465 N ENKUR n/a
6 TRCN0000122699 GCAGCTAGTTTGACTTGGTTT pLKO.1 2328 3UTR 100% 4.950 3.465 N ENKUR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_072993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.