Transcript: Human NR_072994.1

Homo sapiens protein phosphatase 1 regulatory subunit 10 (PPP1R10), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-01-03
Taxon:
Homo sapiens (human)
Gene:
PPP1R10 (5514)
Length:
4543
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_072994.1
NBCI Gene record:
PPP1R10 (5514)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_072994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364102 TTAACAATTGGCTGACGTATT pLKO_005 840 3UTR 100% 10.800 15.120 N PPP1R10 n/a
2 TRCN0000231503 TTGACGTTGGCGGCTACAAAC pLKO_005 816 3UTR 100% 10.800 15.120 N PPP1R10 n/a
3 TRCN0000002479 CGGCTACAAACTTCTTAACAA pLKO.1 826 3UTR 100% 5.625 7.875 N PPP1R10 n/a
4 TRCN0000364101 AGGCAAACTGAGAGAATATTT pLKO_005 1767 3UTR 100% 15.000 12.000 N PPP1R10 n/a
5 TRCN0000002478 CCATTCTTAGTCCTTTCTCAA pLKO.1 3944 3UTR 100% 4.950 3.960 N PPP1R10 n/a
6 TRCN0000002481 GCCACTCAACACAACACCTAA pLKO.1 1408 3UTR 100% 4.950 3.960 N PPP1R10 n/a
7 TRCN0000231505 CAATAGTCAGGAGCGATATAT pLKO_005 1989 3UTR 100% 15.000 10.500 N PPP1R10 n/a
8 TRCN0000231502 CACCAGAAATATTGGTCAAAT pLKO_005 792 3UTR 100% 13.200 9.240 N PPP1R10 n/a
9 TRCN0000231506 CTTTCCAGTATTACCCTTAAT pLKO_005 3671 3UTR 100% 13.200 9.240 N PPP1R10 n/a
10 TRCN0000002480 GAAGGCAAACTGAGAGAATAT pLKO.1 1765 3UTR 100% 13.200 9.240 N PPP1R10 n/a
11 TRCN0000231504 GGATGAAACTGAACGAGTAAA pLKO_005 1800 3UTR 100% 13.200 9.240 N PPP1R10 n/a
12 TRCN0000364100 TCCAGTTCTGGCCAATCTTAT pLKO_005 2220 3UTR 100% 13.200 9.240 N PPP1R10 n/a
13 TRCN0000364105 TCTGACAAGTACAACCTTAAA pLKO_005 1313 3UTR 100% 13.200 9.240 N PPP1R10 n/a
14 TRCN0000368379 ACTGAAACAACCAGACTATTC pLKO_005 2355 3UTR 100% 10.800 7.560 N PPP1R10 n/a
15 TRCN0000364104 CCACTCAACACAACACCTAAT pLKO_005 1409 3UTR 100% 10.800 7.560 N PPP1R10 n/a
16 TRCN0000364106 GATGCACTTACTTGAACATTC pLKO_005 756 3UTR 100% 10.800 7.560 N PPP1R10 n/a
17 TRCN0000364103 GGGCTCAATCAGCTGGATTTG pLKO_005 3876 3UTR 100% 10.800 7.560 N PPP1R10 n/a
18 TRCN0000002477 ACCAGACTATTCGGACAAGAT pLKO.1 2364 3UTR 100% 4.950 3.465 N PPP1R10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_072994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.