Transcript: Mouse NR_073185.1

Mus musculus CAP-GLY domain containing linker protein family, member 4 (Clip4), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Clip4 (78785)
Length:
2661
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073185.1
NBCI Gene record:
Clip4 (78785)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_073185.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180352 GCTCTCCGAGATATGGAATAT pLKO.1 1900 3UTR 100% 13.200 18.480 N Clip4 n/a
2 TRCN0000340365 GGCTCATGGCATCGGTGATAT pLKO_005 589 3UTR 100% 13.200 18.480 N Clip4 n/a
3 TRCN0000340439 TTTAGTTGCTCTCCGAGATAT pLKO_005 1893 3UTR 100% 13.200 18.480 N Clip4 n/a
4 TRCN0000180885 GCTCACAAGCTCTAACGAAAT pLKO.1 2177 3UTR 100% 10.800 15.120 N Clip4 n/a
5 TRCN0000340441 ATGCCACTTGCAGCGACTTTA pLKO_005 771 3UTR 100% 13.200 9.240 N Clip4 n/a
6 TRCN0000183903 CCTGCACATTGCAGCACATAA pLKO.1 805 3UTR 100% 13.200 9.240 N Clip4 n/a
7 TRCN0000180826 GCAGCAAATAACAGTCACCAT pLKO.1 1710 3UTR 100% 2.640 1.848 N Clip4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073185.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.