Transcript: Mouse NR_073508.1

Mus musculus anoctamin 5 (Ano5), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2016-08-26
Taxon:
Mus musculus (mouse)
Gene:
Ano5 (233246)
Length:
7670
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073508.1
NBCI Gene record:
Ano5 (233246)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_073508.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250579 ATCGTTTCTGTTGCAACTAAT pLKO_005 2387 3UTR 100% 13.200 18.480 N Ano5 n/a
2 TRCN0000250576 CCTTGAGTGGATACGTCAATA pLKO_005 2487 3UTR 100% 13.200 18.480 N Ano5 n/a
3 TRCN0000250577 TATCCTACTCCTGAGTATTTC pLKO_005 716 3UTR 100% 13.200 18.480 N Ano5 n/a
4 TRCN0000250578 TAAGCTTGGTAAGGCTATAAA pLKO_005 7489 3UTR 100% 15.000 12.000 N Ano5 n/a
5 TRCN0000250580 GGGAATCAAGATGCCTATTAA pLKO_005 616 3UTR 100% 15.000 10.500 N Ano5 n/a
6 TRCN0000193666 CATGAACAACATCATGGGAAT pLKO.1 2266 3UTR 100% 0.405 0.284 N Ano5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073508.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.