Transcript: Mouse NR_073572.1

Mus musculus abhydrolase domain containing 10 (Abhd10), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2016-09-16
Taxon:
Mus musculus (mouse)
Gene:
Abhd10 (213012)
Length:
2718
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073572.1
NBCI Gene record:
Abhd10 (213012)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_073572.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031627 CCGTACAGTTTCATTAAAGAA pLKO.1 547 3UTR 100% 5.625 7.875 N Abhd10 n/a
2 TRCN0000287938 CCGTACAGTTTCATTAAAGAA pLKO_005 547 3UTR 100% 5.625 7.875 N Abhd10 n/a
3 TRCN0000295369 GTCATAGCTCTTATTGGTATA pLKO_005 358 3UTR 100% 10.800 8.640 N Abhd10 n/a
4 TRCN0000295370 GTGAGGGTGCCATGCTATATT pLKO_005 1279 3UTR 100% 15.000 10.500 N Abhd10 n/a
5 TRCN0000031624 CCACGGCATGAAGGATGAAAT pLKO.1 627 3UTR 100% 13.200 9.240 N Abhd10 n/a
6 TRCN0000288016 CCACGGCATGAAGGATGAAAT pLKO_005 627 3UTR 100% 13.200 9.240 N Abhd10 n/a
7 TRCN0000031628 GCTTTCAACTGTAGTTCCGTA pLKO.1 795 3UTR 100% 2.640 1.848 N Abhd10 n/a
8 TRCN0000287940 GCTTTCAACTGTAGTTCCGTA pLKO_005 795 3UTR 100% 2.640 1.848 N Abhd10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073572.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.