Transcript: Mouse NR_102395.1

Mus musculus fibroblast growth factor 18 (Fgf18), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Fgf18 (14172)
Length:
1593
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_102395.1
NBCI Gene record:
Fgf18 (14172)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_102395.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067180 GCCAAGTACTCTGGTTGGTAT pLKO.1 604 3UTR 100% 4.950 3.960 N Fgf18 n/a
2 TRCN0000067178 CTACCTGTGTATGAACCGAAA pLKO.1 492 3UTR 100% 4.050 2.835 N Fgf18 n/a
3 TRCN0000067179 CCTAGTGGAGACAGATACCTT pLKO.1 432 3UTR 100% 3.000 2.100 N Fgf18 n/a
4 TRCN0000067182 GCCCTTCAAATACACCACAGT pLKO.1 735 3UTR 100% 2.640 1.848 N Fgf18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_102395.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.