Transcript: Human NR_102687.2

Homo sapiens dehydrogenase/reductase 4 like 1 (DHRS4L1), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
DHRS4L1 (728635)
Length:
1093
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_102687.2
NBCI Gene record:
DHRS4L1 (728635)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_102687.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262186 TCTCTTGGCATCGTGTCTTTC pLKO_005 589 3UTR 100% 10.800 7.560 N DHRS4L1 n/a
2 TRCN0000372100 TTACTGTTCACCTCATCAAAT pLKO_005 777 3UTR 100% 13.200 6.600 Y DHRS4L2 n/a
3 TRCN0000221920 CCTAGCACCTGGACTTATCAA pLKO.1 474 3UTR 100% 5.625 2.813 Y DHRS4 n/a
4 TRCN0000028101 CCCAAGGAACATTAGGGTGAA pLKO.1 450 3UTR 100% 4.050 2.025 Y DHRS4L2 n/a
5 TRCN0000221923 CATGAAAGAAACCCTGCGGAT pLKO.1 543 3UTR 100% 2.160 1.080 Y DHRS4 n/a
6 TRCN0000028066 ACCTTACTGTTCACCTCATAA pLKO.1 774 3UTR 100% 13.200 6.600 Y DHRS4L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_102687.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.