Transcript: Mouse NR_102720.1

Mus musculus RAD51 paralog D (Rad51d), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Rad51d (19364)
Length:
6938
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_102720.1
NBCI Gene record:
Rad51d (19364)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_102720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071271 AGCCTGGACAAACTACTTGAT pLKO.1 348 3UTR 100% 4.950 6.930 N Rad51d n/a
2 TRCN0000324996 AGCCTGGACAAACTACTTGAT pLKO_005 348 3UTR 100% 4.950 6.930 N Rad51d n/a
3 TRCN0000071270 GATGATAGACATTGGGACATT pLKO.1 995 3UTR 100% 4.950 3.465 N Rad51d n/a
4 TRCN0000324997 GATGATAGACATTGGGACATT pLKO_005 995 3UTR 100% 4.950 3.465 N Rad51d n/a
5 TRCN0000071268 GCGTAAATAATACATGGCAAA pLKO.1 1970 3UTR 100% 4.050 2.835 N Rad51d n/a
6 TRCN0000325068 GCGTAAATAATACATGGCAAA pLKO_005 1970 3UTR 100% 4.050 2.835 N Rad51d n/a
7 TRCN0000071272 ACGCACAGTATGTCTGACCAA pLKO.1 944 3UTR 100% 2.640 1.848 N Rad51d n/a
8 TRCN0000324998 ACGCACAGTATGTCTGACCAA pLKO_005 944 3UTR 100% 2.640 1.848 N Rad51d n/a
9 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 5139 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_102720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.