Transcript: Human NR_103498.1

Homo sapiens ubiquitin conjugating enzyme E2 F (putative) (UBE2F), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-03-25
Taxon:
Homo sapiens (human)
Gene:
UBE2F (140739)
Length:
2138
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_103498.1
NBCI Gene record:
UBE2F (140739)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_103498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034109 GCAATAAGATACCCGCTACAA pLKO.1 1102 3UTR 100% 4.950 6.930 N UBE2F n/a
2 TRCN0000435832 GATGACTACATCAAACGTTAT pLKO_005 665 3UTR 100% 10.800 8.640 N UBE2F n/a
3 TRCN0000429893 TTCTGCACAAGCGATGCTAAT pLKO_005 1054 3UTR 100% 10.800 7.560 N UBE2F n/a
4 TRCN0000034111 CAAAGTGAAATGCCTGACCAA pLKO.1 424 3UTR 100% 2.640 1.848 N UBE2F n/a
5 TRCN0000034113 CCAAAGTGAAATGCCTGACCA pLKO.1 423 3UTR 100% 2.640 1.848 N UBE2F n/a
6 TRCN0000098573 GCAGAACTTGAAGCTAATTTA pLKO.1 328 3UTR 100% 15.000 7.500 Y Ube2f n/a
7 TRCN0000287847 GCAGAACTTGAAGCTAATTTA pLKO_005 328 3UTR 100% 15.000 7.500 Y Ube2f n/a
8 TRCN0000416997 TGATCCAAACAAGCTTCATTG pLKO_005 375 3UTR 100% 10.800 5.400 Y UBE2F n/a
9 TRCN0000098571 GAGGGTTTCTGTGAGAGACAA pLKO.1 288 3UTR 100% 4.950 2.475 Y Ube2f n/a
10 TRCN0000287774 GAGGGTTTCTGTGAGAGACAA pLKO_005 288 3UTR 100% 4.950 2.475 Y Ube2f n/a
11 TRCN0000034110 CCCACAAGAACATTAAAGGAT pLKO.1 530 3UTR 100% 3.000 1.500 Y UBE2F n/a
12 TRCN0000034112 CAGAACATCATTTGCGGGACA pLKO.1 621 3UTR 100% 2.160 1.080 Y UBE2F n/a
13 TRCN0000098574 GAACATTCAATTGATGGCACT pLKO.1 500 3UTR 100% 2.160 1.080 Y Ube2f n/a
14 TRCN0000287773 GAACATTCAATTGATGGCACT pLKO_005 500 3UTR 100% 2.160 1.080 Y Ube2f n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_103498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.