Transcript: Human NR_103547.1

Homo sapiens FER1L6 antisense RNA 2 (FER1L6-AS2), long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
FER1L6-AS2 (157376)
Length:
1755
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_103547.1
NBCI Gene record:
FER1L6-AS2 (157376)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_103547.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143026 CGCACAAGACATATTCTCGTT pLKO.1 713 3UTR 100% 2.640 3.696 N FER1L6-AS2 n/a
2 TRCN0000141360 CCAGAAGAGAACCTGAGGAAA pLKO.1 329 3UTR 100% 4.950 3.465 N FER1L6-AS2 n/a
3 TRCN0000122470 GCTGAAGTTCGGGTTGTTCTT pLKO.1 203 3UTR 100% 4.950 3.465 N FER1L6-AS2 n/a
4 TRCN0000141333 CCTTCTTCATTTCCCGAACTC pLKO.1 307 3UTR 100% 4.050 2.835 N FER1L6-AS2 n/a
5 TRCN0000141107 CACCTTCTTCATTTCCCGAAC pLKO.1 305 3UTR 100% 2.250 1.575 N FER1L6-AS2 n/a
6 TRCN0000141039 CCCAGATCAAGAAGCTGGTAA pLKO.1 842 3UTR 100% 4.950 2.970 N FER1L6-AS2 n/a
7 TRCN0000141233 CAGGAAAGAACTGCACAGCTT pLKO.1 455 3UTR 100% 2.640 1.584 N FER1L6-AS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_103547.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.