Transcript: Human NR_103740.2

Homo sapiens ATP binding cassette subfamily A member 12 (ABCA12), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ABCA12 (26154)
Length:
9378
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_103740.2
NBCI Gene record:
ABCA12 (26154)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_103740.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059445 CCCTGATAATAGAGCTGAGAT pLKO.1 2206 3UTR 100% 4.950 6.930 N ABCA12 n/a
2 TRCN0000419455 CTTACTCATCCCAGGTAATTT pLKO_005 6101 3UTR 100% 15.000 10.500 N ABCA12 n/a
3 TRCN0000059443 CCGAAGTATATGGGATGTTAT pLKO.1 5040 3UTR 100% 13.200 9.240 N ABCA12 n/a
4 TRCN0000429217 GACTACAGCTTCTCGGTTATT pLKO_005 3955 3UTR 100% 13.200 9.240 N ABCA12 n/a
5 TRCN0000059447 GCCAGCTTTGTCACCTATGTT pLKO.1 6502 3UTR 100% 5.625 3.938 N ABCA12 n/a
6 TRCN0000059446 CCAACTTTATTGTCTCACAAA pLKO.1 7260 3UTR 100% 4.950 3.465 N ABCA12 n/a
7 TRCN0000059444 GCCATTTCTTTGCCTGGCTTA pLKO.1 3824 3UTR 100% 4.050 2.835 N ABCA12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_103740.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.